Transcript: Mouse XM_011248901.1

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 (Adamts2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamts2 (216725)
Length:
6697
CDS:
16..3153

Additional Resources:

NCBI RefSeq record:
XM_011248901.1
NBCI Gene record:
Adamts2 (216725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032393 CCAAGGCGACAAGTCAATGTT pLKO.1 2703 CDS 100% 5.625 4.500 N Adamts2 n/a
2 TRCN0000032391 CCACCATCTGTCTGTCAAGAA pLKO.1 1794 CDS 100% 4.950 3.465 N Adamts2 n/a
3 TRCN0000032389 CCACTGAAGATCACCCAGAAA pLKO.1 2969 CDS 100% 4.950 3.465 N Adamts2 n/a
4 TRCN0000032390 GCAAAGTCCATGAGCCTCATT pLKO.1 484 CDS 100% 4.950 3.465 N Adamts2 n/a
5 TRCN0000032392 CTGTACTTTGAGCACGGTGAT pLKO.1 1408 CDS 100% 4.050 2.835 N Adamts2 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3402 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.