Transcript: Mouse XM_011249009.2

PREDICTED: Mus musculus teneurin transmembrane protein 2 (Tenm2), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tenm2 (23964)
Length:
10245
CDS:
686..8866

Additional Resources:

NCBI RefSeq record:
XM_011249009.2
NBCI Gene record:
Tenm2 (23964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112307 GCCAGGTTTGATTATACCTAT pLKO.1 6800 CDS 100% 4.950 3.960 N Tenm2 n/a
2 TRCN0000112308 CCCTGATTTGTGCAACGGTAA pLKO.1 2992 CDS 100% 4.050 3.240 N Tenm2 n/a
3 TRCN0000112309 CCATTGATTATGACCGAAATA pLKO.1 6084 CDS 100% 13.200 9.240 N Tenm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.