Transcript: Mouse XM_011249156.3

PREDICTED: Mus musculus solute carrier family 22 (organic cation transporter), member 21 (Slc22a21), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Slc22a21 (56517)
Length:
2453
CDS:
100..1158

Additional Resources:

NCBI RefSeq record:
XM_011249156.3
NBCI Gene record:
Slc22a21 (56517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070249 CCGCCTACCTTATATCCTCAT pLKO.1 936 CDS 100% 4.050 5.670 N Slc22a21 n/a
2 TRCN0000070252 CGAGATGTTTACTCTGCTCTA pLKO.1 214 CDS 100% 4.050 5.670 N Slc22a21 n/a
3 TRCN0000070251 CCCGAAGGAGTCTAAAGGAAA pLKO.1 1095 CDS 100% 4.950 3.465 N Slc22a21 n/a
4 TRCN0000070248 CCGACAACAGTGCTTTCTGTT pLKO.1 1225 3UTR 100% 0.495 0.347 N Slc22a21 n/a
5 TRCN0000070250 CCTTGTTGGAATGGGACATAT pLKO.1 238 CDS 100% 13.200 7.920 N Slc22a21 n/a
6 TRCN0000295789 GCTAGACATGCTTTGTTATTT pLKO_005 1420 3UTR 100% 15.000 7.500 Y Slc22a5 n/a
7 TRCN0000295729 GACCATATCAGTGGGCTATTT pLKO_005 528 CDS 100% 13.200 6.600 Y Slc22a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.