Transcript: Mouse XM_011249191.2

PREDICTED: Mus musculus matrix-remodelling associated 7 (Mxra7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mxra7 (67622)
Length:
3070
CDS:
71..526

Additional Resources:

NCBI RefSeq record:
XM_011249191.2
NBCI Gene record:
Mxra7 (67622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144202 CAAGAAGATGATGACCAAAGA pLKO.1 451 CDS 100% 4.950 3.465 N MXRA7 n/a
2 TRCN0000195931 CAGGATGAAGACTCAGACAGT pLKO.1 338 CDS 100% 2.640 1.848 N Mxra7 n/a
3 TRCN0000145339 GTACAAGAAGATGATGACCAA pLKO.1 448 CDS 100% 2.640 1.848 N MXRA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.