Transcript: Mouse XM_011249195.2

PREDICTED: Mus musculus family with sequence similarity 114, member A2 (Fam114a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam114a2 (67726)
Length:
2597
CDS:
104..1576

Additional Resources:

NCBI RefSeq record:
XM_011249195.2
NBCI Gene record:
Fam114a2 (67726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277243 CAAGAAATACAGCCTACAAAT pLKO_005 1065 CDS 100% 13.200 9.240 N Fam114a2 n/a
2 TRCN0000277282 TACAGTAGGACAAGGTATTTC pLKO_005 376 CDS 100% 13.200 9.240 N Fam114a2 n/a
3 TRCN0000176895 GAAAGTGAGATAAAGGTGAAA pLKO.1 845 CDS 100% 4.950 3.465 N Fam114a2 n/a
4 TRCN0000277241 GAAAGTGAGATAAAGGTGAAA pLKO_005 845 CDS 100% 4.950 3.465 N Fam114a2 n/a
5 TRCN0000181964 CCAGAATAAAGCCTGTGGCTT pLKO.1 2015 3UTR 100% 2.640 1.848 N Fam114a2 n/a
6 TRCN0000177007 GCTCAATAGAATTGTTCCACA pLKO.1 1233 CDS 100% 2.640 1.848 N Fam114a2 n/a
7 TRCN0000277279 GCTCAATAGAATTGTTCCACA pLKO_005 1233 CDS 100% 2.640 1.848 N Fam114a2 n/a
8 TRCN0000176811 GCTTTCTCCTTTCCAGAATAA pLKO.1 2003 3UTR 100% 13.200 7.920 N Fam114a2 n/a
9 TRCN0000277280 GCTTTCTCCTTTCCAGAATAA pLKO_005 2003 3UTR 100% 13.200 7.920 N Fam114a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.