Transcript: Mouse XM_011249327.2

PREDICTED: Mus musculus testis expressed gene 14 (Tex14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tex14 (83560)
Length:
4782
CDS:
112..4479

Additional Resources:

NCBI RefSeq record:
XM_011249327.2
NBCI Gene record:
Tex14 (83560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026934 CCGGAACCTTACTATGATATT pLKO.1 1534 CDS 100% 13.200 18.480 N Tex14 n/a
2 TRCN0000218381 CTATGATCAAGACGGCTATTT pLKO_005 3546 CDS 100% 13.200 18.480 N Tex14 n/a
3 TRCN0000229523 CTAACGTTTCTGCGGCATTTG pLKO_005 3878 CDS 100% 10.800 15.120 N Tex14 n/a
4 TRCN0000026871 CCTCCATCTTTGGCCTATCTT pLKO.1 2500 CDS 100% 5.625 7.875 N Tex14 n/a
5 TRCN0000361888 CGCTAAGCCCAGAGTCGATTT pLKO_005 3626 CDS 100% 10.800 8.640 N Tex14 n/a
6 TRCN0000226383 CCTTCAAGATATTCGTTATAT pLKO_005 1599 CDS 100% 15.000 10.500 N Tex14 n/a
7 TRCN0000229522 CCAGCGCTTCACTGGTATTAG pLKO_005 3183 CDS 100% 13.200 9.240 N Tex14 n/a
8 TRCN0000368817 CTGCTACTATGGGCACAATAA pLKO_005 4588 3UTR 100% 13.200 9.240 N Tex14 n/a
9 TRCN0000229524 GTGTAGCATGCTTAATCATTT pLKO_005 4623 3UTR 100% 13.200 9.240 N Tex14 n/a
10 TRCN0000361896 TGGATGTTCTGGTGGATTATG pLKO_005 326 CDS 100% 13.200 9.240 N Tex14 n/a
11 TRCN0000026868 CCCAAAGGAAATACGAAGTTT pLKO.1 3106 CDS 100% 5.625 3.938 N Tex14 n/a
12 TRCN0000026931 CCTCAGTTTCAAGCTATTCAA pLKO.1 3424 CDS 100% 5.625 3.938 N Tex14 n/a
13 TRCN0000026895 CCTTGGAAGAAGATGAACTAA pLKO.1 4379 CDS 100% 5.625 3.938 N Tex14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.