Transcript: Mouse XM_011249446.2

PREDICTED: Mus musculus checkpoint with forkhead and ring finger domains (Chfr), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chfr (231600)
Length:
3143
CDS:
501..2075

Additional Resources:

NCBI RefSeq record:
XM_011249446.2
NBCI Gene record:
Chfr (231600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124630 CGCAGTTCACTTGTTGCAAAT pLKO.1 732 CDS 100% 10.800 15.120 N Chfr n/a
2 TRCN0000124631 GAATCGGACATCCTGAAGAAT pLKO.1 1746 CDS 100% 5.625 7.875 N Chfr n/a
3 TRCN0000124629 GCCATGTCATCTGGAATAATA pLKO.1 2910 3UTR 100% 15.000 10.500 N Chfr n/a
4 TRCN0000124633 CCAATGGAACAGTGATCAATA pLKO.1 316 5UTR 100% 13.200 9.240 N Chfr n/a
5 TRCN0000007705 GCATACCTCTATGAATCTTTA pLKO.1 429 5UTR 100% 13.200 9.240 N CHFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.