Transcript: Mouse XM_011249467.2

PREDICTED: Mus musculus adhesion G protein-coupled receptor L3 (Adgrl3), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrl3 (319387)
Length:
13705
CDS:
2033..6628

Additional Resources:

NCBI RefSeq record:
XM_011249467.2
NBCI Gene record:
Adgrl3 (319387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011695 CCCGAGAAATCATGTGGTTTA pLKO.1 3540 CDS 100% 10.800 15.120 N ADGRL3 n/a
2 TRCN0000174475 CGGTAATAAGATTGACTACAT pLKO.1 3037 CDS 100% 4.950 6.930 N Adgrl3 n/a
3 TRCN0000011692 CCAGAATTTGAGTCCTGTTAA pLKO.1 7349 3UTR 100% 13.200 9.240 N ADGRL3 n/a
4 TRCN0000174411 CCTGTGGTATTTACTGTTAAA pLKO.1 4427 CDS 100% 13.200 9.240 N Adgrl3 n/a
5 TRCN0000174678 GCCAGAACTATTGTTTGAAAT pLKO.1 7022 3UTR 100% 13.200 9.240 N Adgrl3 n/a
6 TRCN0000194560 GATGGAGAACATTCGGTGTTA pLKO.1 2248 CDS 100% 4.950 2.970 N Adgrl3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8352 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.