Transcript: Mouse XM_011249482.3

PREDICTED: Mus musculus RIKEN cDNA C530008M17 gene (C530008M17Rik), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
C530008M17Rik (320827)
Length:
6879
CDS:
135..4010

Additional Resources:

NCBI RefSeq record:
XM_011249482.3
NBCI Gene record:
C530008M17Rik (320827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377174 AGCGACAGTTGGGCAAGAATA pLKO_005 253 CDS 100% 13.200 18.480 N C530008M17Rik n/a
2 TRCN0000376140 GCCATTCTAGCGGTCACTATG pLKO_005 3085 CDS 100% 10.800 15.120 N C530008M17Rik n/a
3 TRCN0000367015 AGAAGGTTGCTCCAGTTAAAC pLKO_005 484 CDS 100% 13.200 9.240 N C530008M17Rik n/a
4 TRCN0000367016 CAAGAGAGACCTTCGCTAATT pLKO_005 3456 CDS 100% 13.200 9.240 N C530008M17Rik n/a
5 TRCN0000376139 CCACCCATGGCCTTCACATAT pLKO_005 4303 3UTR 100% 13.200 9.240 N C530008M17Rik n/a
6 TRCN0000367061 GTTCGTTGTAAAGAGTGTATT pLKO_005 4165 3UTR 100% 13.200 9.240 N C530008M17Rik n/a
7 TRCN0000376203 ATTGAGAAGGACCAACTATTC pLKO_005 2861 CDS 100% 10.800 7.560 N C530008M17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.