Transcript: Mouse XM_011249542.1

PREDICTED: Mus musculus solute carrier family 4 (anion exchanger), member 4 (Slc4a4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc4a4 (54403)
Length:
7396
CDS:
2..3355

Additional Resources:

NCBI RefSeq record:
XM_011249542.1
NBCI Gene record:
Slc4a4 (54403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314103 CCGAGAACTACTCCGACAAAT pLKO_005 183 CDS 100% 13.200 18.480 N Slc4a4 n/a
2 TRCN0000350042 GAGCCTGAAGACAACGATTAT pLKO_005 3299 CDS 100% 13.200 18.480 N Slc4a4 n/a
3 TRCN0000069886 GCGAGGTGGATTAAGTTTGAA pLKO.1 386 CDS 100% 5.625 7.875 N Slc4a4 n/a
4 TRCN0000314104 TCTACTGACATGTACCATAAT pLKO_005 2033 CDS 100% 13.200 9.240 N Slc4a4 n/a
5 TRCN0000069887 CCCATCAACTCTGACTTCAAA pLKO.1 1904 CDS 100% 5.625 3.938 N Slc4a4 n/a
6 TRCN0000317832 CCCATCAACTCTGACTTCAAA pLKO_005 1904 CDS 100% 5.625 3.938 N Slc4a4 n/a
7 TRCN0000350093 CAACAGTGGCTGCAATTATTT pLKO_005 2976 CDS 100% 15.000 9.000 N Slc4a4 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4220 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.