Transcript: Mouse XM_011249654.2

PREDICTED: Mus musculus potassium large conductance calcium-activated channel, subfamily M, beta member 3 (Kcnmb3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnmb3 (100502876)
Length:
5247
CDS:
49..705

Additional Resources:

NCBI RefSeq record:
XM_011249654.2
NBCI Gene record:
Kcnmb3 (100502876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069861 GTTGTCTTTCACTGCTTATTT pLKO.1 577 CDS 100% 15.000 10.500 N Kcnmb3 n/a
2 TRCN0000069859 CGATCACAACAATGGAACTTT pLKO.1 495 CDS 100% 5.625 3.938 N Kcnmb3 n/a
3 TRCN0000069858 CCCTGATTGTTGGCTTGGTTA pLKO.1 626 CDS 100% 4.950 3.465 N Kcnmb3 n/a
4 TRCN0000069860 CGTCCTGGACATCAAGGAATT pLKO.1 471 CDS 100% 0.000 0.000 N Kcnmb3 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1462 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.