Transcript: Mouse XM_011249659.2

PREDICTED: Mus musculus MDS1 and EVI1 complex locus (Mecom), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mecom (14013)
Length:
3485
CDS:
48..3386

Additional Resources:

NCBI RefSeq record:
XM_011249659.2
NBCI Gene record:
Mecom (14013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002529 GCACTACGTCTTCCTTAAATA pLKO.1 1216 CDS 100% 15.000 21.000 N MECOM n/a
2 TRCN0000218351 ATAAAGGCTATTGCGTCTATT pLKO_005 1956 CDS 100% 13.200 18.480 N Mecom n/a
3 TRCN0000234044 CTTTACAGAGATCCGCAATTT pLKO_005 3065 CDS 100% 13.200 18.480 N Mecom n/a
4 TRCN0000096094 CCCATTTATAGAGTAGAGAAA pLKO.1 2451 CDS 100% 4.950 6.930 N Mecom n/a
5 TRCN0000096097 GCAAATACTGTGATAGATCAT pLKO.1 2824 CDS 100% 4.950 6.930 N Mecom n/a
6 TRCN0000085077 AGGAAGATTGAAATAGGCGAA pLKO.1 261 CDS 100% 2.160 3.024 N Mecom n/a
7 TRCN0000085076 GCCATACAAAGCTCCCATCTA pLKO.1 155 CDS 100% 4.950 3.960 N Mecom n/a
8 TRCN0000234041 TTAACTGGAAGTCCAATTTAA pLKO_005 868 CDS 100% 15.000 10.500 N Mecom n/a
9 TRCN0000096098 CCAATCACCAAGTGAAGTTAA pLKO.1 2144 CDS 100% 13.200 9.240 N Mecom n/a
10 TRCN0000234043 CTCAATCAATGTACCCATTTC pLKO_005 2083 CDS 100% 10.800 7.560 N Mecom n/a
11 TRCN0000234042 GCAACCTTCAGCGACACATTC pLKO_005 967 CDS 100% 10.800 7.560 N Mecom n/a
12 TRCN0000096095 CCCAATCACCAAGTGAAGTTA pLKO.1 2143 CDS 100% 5.625 3.938 N Mecom n/a
13 TRCN0000085075 CCTATGGCAACTATCCTGAAA pLKO.1 13 5UTR 100% 4.950 3.465 N Mecom n/a
14 TRCN0000085074 CCAGTGAGTCATTTACTCCTA pLKO.1 124 CDS 100% 2.640 1.848 N Mecom n/a
15 TRCN0000015587 CCTTTGGAAGAAATGCCAGAT pLKO.1 36 5UTR 100% 4.050 2.430 N MECOM n/a
16 TRCN0000015585 CCCATCTACATCCCTGATGAT pLKO.1 168 CDS 100% 4.950 3.465 N MECOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.