Transcript: Mouse XM_011249664.2

PREDICTED: Mus musculus MDS1 and EVI1 complex locus (Mecom), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mecom (14013)
Length:
2668
CDS:
99..2546

Additional Resources:

NCBI RefSeq record:
XM_011249664.2
NBCI Gene record:
Mecom (14013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234044 CTTTACAGAGATCCGCAATTT pLKO_005 2225 CDS 100% 13.200 18.480 N Mecom n/a
2 TRCN0000096094 CCCATTTATAGAGTAGAGAAA pLKO.1 1638 CDS 100% 4.950 6.930 N Mecom n/a
3 TRCN0000096097 GCAAATACTGTGATAGATCAT pLKO.1 1984 CDS 100% 4.950 6.930 N Mecom n/a
4 TRCN0000085077 AGGAAGATTGAAATAGGCGAA pLKO.1 423 CDS 100% 2.160 3.024 N Mecom n/a
5 TRCN0000085076 GCCATACAAAGCTCCCATCTA pLKO.1 317 CDS 100% 4.950 3.960 N Mecom n/a
6 TRCN0000234041 TTAACTGGAAGTCCAATTTAA pLKO_005 1030 CDS 100% 15.000 10.500 N Mecom n/a
7 TRCN0000096098 CCAATCACCAAGTGAAGTTAA pLKO.1 1331 CDS 100% 13.200 9.240 N Mecom n/a
8 TRCN0000234043 CTCAATCAATGTACCCATTTC pLKO_005 1270 CDS 100% 10.800 7.560 N Mecom n/a
9 TRCN0000234042 GCAACCTTCAGCGACACATTC pLKO_005 1126 CDS 100% 10.800 7.560 N Mecom n/a
10 TRCN0000096095 CCCAATCACCAAGTGAAGTTA pLKO.1 1330 CDS 100% 5.625 3.938 N Mecom n/a
11 TRCN0000085075 CCTATGGCAACTATCCTGAAA pLKO.1 175 CDS 100% 4.950 3.465 N Mecom n/a
12 TRCN0000085074 CCAGTGAGTCATTTACTCCTA pLKO.1 286 CDS 100% 2.640 1.848 N Mecom n/a
13 TRCN0000015587 CCTTTGGAAGAAATGCCAGAT pLKO.1 198 CDS 100% 4.050 2.430 N MECOM n/a
14 TRCN0000015585 CCCATCTACATCCCTGATGAT pLKO.1 330 CDS 100% 4.950 3.465 N MECOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.