Transcript: Mouse XM_011249695.2

PREDICTED: Mus musculus peroxisomal biogenesis factor 5-like (Pex5l), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pex5l (58869)
Length:
3211
CDS:
227..2173

Additional Resources:

NCBI RefSeq record:
XM_011249695.2
NBCI Gene record:
Pex5l (58869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093481 AGAGACATCATCCTTAGATTT pLKO.1 772 CDS 100% 13.200 18.480 N Pex5l n/a
2 TRCN0000454380 ATAAGCCAAGGGAATTGATTT pLKO_005 2320 3UTR 100% 13.200 18.480 N Pex5l n/a
3 TRCN0000448174 CACACGGCGGATGTCTAAATC pLKO_005 1612 CDS 100% 13.200 18.480 N Pex5l n/a
4 TRCN0000444015 ATAGAGCAATCGATGCATTTA pLKO_005 1764 CDS 100% 13.200 10.560 N Pex5l n/a
5 TRCN0000450475 CAAGTGTACTTTGAGTTATAT pLKO_005 2457 3UTR 100% 15.000 10.500 N Pex5l n/a
6 TRCN0000093483 CATTCCTTGGAAGAGGAGTTT pLKO.1 1070 CDS 100% 4.950 3.465 N Pex5l n/a
7 TRCN0000093479 GCTTCCGAGTTGGAACTTGTA pLKO.1 986 CDS 100% 4.950 3.465 N Pex5l n/a
8 TRCN0000093482 CATGGCAGTTTCTTGGTATAA pLKO.1 1377 CDS 100% 13.200 7.920 N Pex5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.