Transcript: Mouse XM_011249699.2

PREDICTED: Mus musculus peroxisomal biogenesis factor 5-like (Pex5l), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pex5l (58869)
Length:
3253
CDS:
365..2215

Additional Resources:

NCBI RefSeq record:
XM_011249699.2
NBCI Gene record:
Pex5l (58869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093481 AGAGACATCATCCTTAGATTT pLKO.1 814 CDS 100% 13.200 18.480 N Pex5l n/a
2 TRCN0000454380 ATAAGCCAAGGGAATTGATTT pLKO_005 2362 3UTR 100% 13.200 18.480 N Pex5l n/a
3 TRCN0000448174 CACACGGCGGATGTCTAAATC pLKO_005 1654 CDS 100% 13.200 18.480 N Pex5l n/a
4 TRCN0000444015 ATAGAGCAATCGATGCATTTA pLKO_005 1806 CDS 100% 13.200 10.560 N Pex5l n/a
5 TRCN0000093480 CCATCTCTACTTAATGCCCTT pLKO.1 401 CDS 100% 2.160 1.728 N Pex5l n/a
6 TRCN0000450475 CAAGTGTACTTTGAGTTATAT pLKO_005 2499 3UTR 100% 15.000 10.500 N Pex5l n/a
7 TRCN0000093483 CATTCCTTGGAAGAGGAGTTT pLKO.1 1112 CDS 100% 4.950 3.465 N Pex5l n/a
8 TRCN0000093479 GCTTCCGAGTTGGAACTTGTA pLKO.1 1028 CDS 100% 4.950 3.465 N Pex5l n/a
9 TRCN0000093482 CATGGCAGTTTCTTGGTATAA pLKO.1 1419 CDS 100% 13.200 7.920 N Pex5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.