Transcript: Mouse XM_011249909.2

PREDICTED: Mus musculus BTB and CNC homology, basic leucine zipper transcription factor 2 (Bach2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bach2 (12014)
Length:
9117
CDS:
785..3304

Additional Resources:

NCBI RefSeq record:
XM_011249909.2
NBCI Gene record:
Bach2 (12014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432631 TGCGGTCTCTGTTCGGTATAA pLKO_005 1803 CDS 100% 13.200 18.480 N Bach2 n/a
2 TRCN0000084330 CCAGTACCCTAGATATAAGAA pLKO.1 1459 CDS 100% 5.625 7.875 N Bach2 n/a
3 TRCN0000084329 GAGCAGTCTTACGGAACCAAT pLKO.1 2525 CDS 100% 4.950 6.930 N Bach2 n/a
4 TRCN0000436191 TGAAGAACCAAGAGCGAATTT pLKO_005 3410 3UTR 100% 13.200 9.240 N Bach2 n/a
5 TRCN0000084331 GCAACACCTCTGAGAATTGTA pLKO.1 3129 CDS 100% 5.625 3.938 N Bach2 n/a
6 TRCN0000084328 GCTTCTATACACATCAAAGTT pLKO.1 3707 3UTR 100% 5.625 3.938 N Bach2 n/a
7 TRCN0000084332 GACCAACGGAAGAAGGACATT pLKO.1 869 CDS 100% 4.950 3.465 N Bach2 n/a
8 TRCN0000423629 TGGCCGCATGCAGTGAATATT pLKO_005 948 CDS 100% 15.000 10.500 N BACH2 n/a
9 TRCN0000436687 ATTAAATGTGAGCAGTCTTAT pLKO_005 2516 CDS 100% 13.200 9.240 N BACH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.