Transcript: Mouse XM_011249992.2

PREDICTED: Mus musculus PHD finger protein 24 (Phf24), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf24 (230085)
Length:
9037
CDS:
3285..4487

Additional Resources:

NCBI RefSeq record:
XM_011249992.2
NBCI Gene record:
Phf24 (230085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190862 CGGCATTCTTGGTTCTGTAAA pLKO.1 4242 CDS 100% 13.200 18.480 N Phf24 n/a
2 TRCN0000202310 GAGACCTTTCAGCGGTGTAAA pLKO.1 3897 CDS 100% 13.200 18.480 N Phf24 n/a
3 TRCN0000249756 GAGACCTTTCAGCGGTGTAAA pLKO_005 3897 CDS 100% 13.200 18.480 N Phf24 n/a
4 TRCN0000263372 GAGACCTTTCAGCGGTGTAAA pLKO_005 3897 CDS 100% 13.200 18.480 N PHF24 n/a
5 TRCN0000249755 ACCTAGAAGCAGGGTAGTATA pLKO_005 6070 3UTR 100% 13.200 10.560 N Phf24 n/a
6 TRCN0000249753 TACTGAGGAGGAGATGTATAG pLKO_005 3869 CDS 100% 10.800 7.560 N Phf24 n/a
7 TRCN0000249754 TCAGCCATGTTGGGCCTATAG pLKO_005 4297 CDS 100% 10.800 7.560 N Phf24 n/a
8 TRCN0000249752 TTACTACTGTGACAACCTTAA pLKO_005 3839 CDS 100% 10.800 6.480 N Phf24 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2575 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.