Transcript: Mouse XM_011250124.2

PREDICTED: Mus musculus nuclear transcription factor, X-box binding 1 (Nfx1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nfx1 (74164)
Length:
3618
CDS:
68..2515

Additional Resources:

NCBI RefSeq record:
XM_011250124.2
NBCI Gene record:
Nfx1 (74164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311056 GATTGTGCGGACGGCATAAAT pLKO_005 2124 CDS 100% 15.000 21.000 N Nfx1 n/a
2 TRCN0000304626 ACGTCAGATACATCTAGTTTA pLKO_005 440 CDS 100% 13.200 18.480 N Nfx1 n/a
3 TRCN0000085127 GTTCCCTGATTGAGCAGCTAA pLKO.1 1083 CDS 100% 4.950 6.930 N Nfx1 n/a
4 TRCN0000014905 CCAGTATATCATTCTTGTCAT pLKO.1 2390 CDS 100% 4.950 3.960 N NFX1 n/a
5 TRCN0000085125 CCCAAAGAAGACTAGATTCTA pLKO.1 168 CDS 100% 5.625 3.938 N Nfx1 n/a
6 TRCN0000331788 CCCAAAGAAGACTAGATTCTA pLKO_005 168 CDS 100% 5.625 3.938 N Nfx1 n/a
7 TRCN0000014904 GCAGAAATGAAATTCCACATA pLKO.1 1344 CDS 100% 4.950 3.465 N NFX1 n/a
8 TRCN0000085124 GCTACATTTATGTGCGACAAA pLKO.1 2087 CDS 100% 4.950 3.465 N Nfx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.