Transcript: Mouse XM_011250273.2

PREDICTED: Mus musculus phospholipase C, eta 2 (Plch2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plch2 (269615)
Length:
5496
CDS:
194..4960

Additional Resources:

NCBI RefSeq record:
XM_011250273.2
NBCI Gene record:
Plch2 (269615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097093 GTCATCGAAACCATCAACAAA pLKO.1 1367 CDS 100% 5.625 3.938 N Plch2 n/a
2 TRCN0000452720 AGCCGCTGAGTCACTACTTCA pLKO_005 1161 CDS 100% 4.950 3.465 N Plch2 n/a
3 TRCN0000097092 GCTACATAAACTCAACGTGAA pLKO.1 703 CDS 100% 4.050 2.835 N Plch2 n/a
4 TRCN0000097089 CCCATTCTTCTGTCTGTGGAA pLKO.1 5086 3UTR 100% 2.640 1.848 N Plch2 n/a
5 TRCN0000097090 CCTGCCAATATCAGTGAGGAT pLKO.1 1592 CDS 100% 2.640 1.848 N Plch2 n/a
6 TRCN0000097091 GCTGACCTACAGCAACCATAA pLKO.1 856 CDS 100% 10.800 6.480 N Plch2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.