Transcript: Mouse XM_011250304.1

PREDICTED: Mus musculus cyclin L2 (Ccnl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccnl2 (56036)
Length:
1645
CDS:
89..985

Additional Resources:

NCBI RefSeq record:
XM_011250304.1
NBCI Gene record:
Ccnl2 (56036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262721 CGTGAGCGCTCAAGGTCATAT pLKO_005 905 CDS 100% 13.200 10.560 N Ccnl2 n/a
2 TRCN0000262717 TTTACCCAATCGTCCACATTG pLKO_005 187 CDS 100% 10.800 8.640 N Ccnl2 n/a
3 TRCN0000262719 GTGCATCTGTCCCGGTTAATG pLKO_005 1153 3UTR 100% 13.200 9.240 N Ccnl2 n/a
4 TRCN0000071795 CCCTGTAAATGGCTTGCTGAA pLKO.1 526 CDS 100% 4.050 2.835 N Ccnl2 n/a
5 TRCN0000071794 CCGGAAATCAAAGGACTGCAA pLKO.1 757 CDS 100% 2.640 1.848 N Ccnl2 n/a
6 TRCN0000071797 GCTTCTCCAAAGAGAAGGAAA pLKO.1 614 CDS 100% 0.495 0.248 Y Ccnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.