Transcript: Mouse XM_011250325.2

PREDICTED: Mus musculus UBX domain protein 11 (Ubxn11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubxn11 (67586)
Length:
1408
CDS:
17..1381

Additional Resources:

NCBI RefSeq record:
XM_011250325.2
NBCI Gene record:
Ubxn11 (67586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415868 AGCGGTTTCTCAGCGACTATG pLKO_005 351 CDS 100% 10.800 15.120 N Ubxn11 n/a
2 TRCN0000030074 CCCAAGTGTATAATCCGACAA pLKO.1 929 CDS 100% 4.050 5.670 N Ubxn11 n/a
3 TRCN0000030077 CGGAATGGCATTATGATGTTT pLKO.1 632 CDS 100% 5.625 4.500 N Ubxn11 n/a
4 TRCN0000421736 ACGGTCTACCAGGACGATACA pLKO_005 1256 CDS 100% 4.950 3.960 N Ubxn11 n/a
5 TRCN0000030075 CCAGGATGACTGCTGAACAAT pLKO.1 894 CDS 100% 5.625 3.938 N Ubxn11 n/a
6 TRCN0000030078 CCAAGACTCAGAAGAGAAGAT pLKO.1 24 CDS 100% 4.950 2.970 N Ubxn11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.