Transcript: Mouse XM_011250453.2

PREDICTED: Mus musculus olfactory receptor 5 (Olfr5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr5 (18349)
Length:
1260
CDS:
322..1260

Additional Resources:

NCBI RefSeq record:
XM_011250453.2
NBCI Gene record:
Olfr5 (18349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187504 GCTATGATTTCATGGCTAGGT pLKO.1 766 CDS 100% 2.640 3.696 N Olfr5 n/a
2 TRCN0000203677 CCATTACTCAACCTGTCATGT pLKO.1 880 CDS 100% 4.950 3.465 N Olfr5 n/a
3 TRCN0000189151 GCAGTTCATCTTGCTGGGATT pLKO.1 363 CDS 100% 4.050 2.835 N Olfr5 n/a
4 TRCN0000187391 CTATGGAATGGACTCTACCAT pLKO.1 586 CDS 100% 3.000 2.100 N Olfr5 n/a
5 TRCN0000204029 GCATCTTCTACTCAGTCACTA pLKO.1 1079 CDS 100% 4.950 2.970 N Olfr5 n/a
6 TRCN0000203878 CAAGCCCATGTACTTCTTCTT pLKO.1 501 CDS 100% 4.950 2.475 Y Olfr5 n/a
7 TRCN0000204255 CCACAAGCCCATGTACTTCTT pLKO.1 498 CDS 100% 4.950 2.475 Y Olfr1336 n/a
8 TRCN0000204439 CCTGGAGAACACACTCATCAT pLKO.1 450 CDS 100% 4.950 2.475 Y Olfr5 n/a
9 TRCN0000186124 CACACTCATCATCTACCTCAT pLKO.1 459 CDS 100% 4.050 2.025 Y Olfr1348 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.