Transcript: Mouse XM_011250560.1

PREDICTED: Mus musculus coiled-coil domain containing 9 (Ccdc9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc9 (243846)
Length:
2252
CDS:
206..1981

Additional Resources:

NCBI RefSeq record:
XM_011250560.1
NBCI Gene record:
Ccdc9 (243846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250764 GCCTATAGTGACCACGATAAT pLKO_005 1283 CDS 100% 13.200 18.480 N Ccdc9 n/a
2 TRCN0000193716 CAGGCAGAATATCGAGAAGAT pLKO.1 685 CDS 100% 4.950 6.930 N Ccdc9 n/a
3 TRCN0000250762 CGAGTCCTCTCAGTCCATATC pLKO_005 1342 CDS 100% 10.800 7.560 N Ccdc9 n/a
4 TRCN0000250760 GGACGTGAGTGAAGATGTTAC pLKO_005 1504 CDS 100% 10.800 7.560 N Ccdc9 n/a
5 TRCN0000250763 TGGAGAAGATTGCCGAATATG pLKO_005 717 CDS 100% 13.200 7.920 N Ccdc9 n/a
6 TRCN0000173409 GAGGAAGATGGTGAGGAAGAT pLKO.1 1424 CDS 100% 4.950 2.970 N Ccdc9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.