Transcript: Mouse XM_011250605.2

PREDICTED: Mus musculus carcinoembryonic antigen-related cell adhesion molecule 16 (Ceacam16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ceacam16 (330483)
Length:
2548
CDS:
1062..2342

Additional Resources:

NCBI RefSeq record:
XM_011250605.2
NBCI Gene record:
Ceacam16 (330483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252159 CGCACGGGCTGCACTATTAAA pLKO_005 1767 CDS 100% 15.000 21.000 N Ceacam16 n/a
2 TRCN0000252162 ATCGTTCCTGTACCGACTAAG pLKO_005 2025 CDS 100% 10.800 15.120 N Ceacam16 n/a
3 TRCN0000252161 GCCACTGAACTTGACGGTATA pLKO_005 1703 CDS 100% 10.800 15.120 N Ceacam16 n/a
4 TRCN0000252158 GGGAACTGCTTGCCTACAATT pLKO_005 1204 CDS 100% 13.200 9.240 N Ceacam16 n/a
5 TRCN0000252160 CCAAGGACCTGCTAGTCTATG pLKO_005 2089 CDS 100% 10.800 7.560 N Ceacam16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.