Transcript: Mouse XM_011250670.1

PREDICTED: Mus musculus zinc finger protein 524 (Zfp524), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp524 (66056)
Length:
1464
CDS:
446..1411

Additional Resources:

NCBI RefSeq record:
XM_011250670.1
NBCI Gene record:
Zfp524 (66056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096725 GCGCCATTACAAACGCAAACA pLKO.1 1072 CDS 100% 4.950 6.930 N Zfp524 n/a
2 TRCN0000096724 CGCCATTGTAACATCCATGCT pLKO.1 905 CDS 100% 2.640 2.112 N Zfp524 n/a
3 TRCN0000096726 CTGAAGGAAAGGAGCCTACTT pLKO.1 1206 CDS 100% 4.950 3.465 N Zfp524 n/a
4 TRCN0000096728 GATCTTCTGTTGATCGATGAT pLKO.1 674 CDS 100% 4.950 3.465 N Zfp524 n/a
5 TRCN0000096727 GACCTTACCAATGTCCCTCAT pLKO.1 1017 CDS 100% 4.050 2.835 N Zfp524 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.