Transcript: Mouse XM_011250782.1

PREDICTED: Mus musculus basonuclin 1 (Bnc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bnc1 (12173)
Length:
4883
CDS:
243..3197

Additional Resources:

NCBI RefSeq record:
XM_011250782.1
NBCI Gene record:
Bnc1 (12173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374542 TAAGCGACTCCAGCTCATATA pLKO_005 1174 CDS 100% 13.200 18.480 N Bnc1 n/a
2 TRCN0000313061 TACAACGCCGTCCACCTAAAG pLKO_005 1341 CDS 100% 10.800 15.120 N Bnc1 n/a
3 TRCN0000095487 CGAAGGGTGTAACATGGTGTT pLKO.1 1382 CDS 100% 4.050 5.670 N Bnc1 n/a
4 TRCN0000095488 CCAATGTTTCAAACCTGGGAA pLKO.1 350 CDS 100% 2.640 3.696 N Bnc1 n/a
5 TRCN0000095484 GCCTTGTTCTATGTCTTAATA pLKO.1 4242 3UTR 100% 15.000 10.500 N Bnc1 n/a
6 TRCN0000313062 GGGTAGCCCTTCCTATTATTT pLKO_005 3370 3UTR 100% 15.000 10.500 N Bnc1 n/a
7 TRCN0000095486 GCAGTCTGGTTTACCCAATAT pLKO.1 2695 CDS 100% 13.200 9.240 N Bnc1 n/a
8 TRCN0000312123 GCAGTCTGGTTTACCCAATAT pLKO_005 2695 CDS 100% 13.200 9.240 N Bnc1 n/a
9 TRCN0000374541 TATAAGTGTTTGCCATATTTC pLKO_005 3213 3UTR 100% 13.200 9.240 N Bnc1 n/a
10 TRCN0000313101 AGGATTACATCCGTGGATATG pLKO_005 628 CDS 100% 10.800 7.560 N Bnc1 n/a
11 TRCN0000095485 CGTGGATATGTGTTACAGGAT pLKO.1 639 CDS 100% 2.640 1.848 N Bnc1 n/a
12 TRCN0000016596 GCAGTCTGGTTTACCCAATAA pLKO.1 2695 CDS 100% 13.200 9.240 N BNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.