Transcript: Mouse XM_011250864.1

PREDICTED: Mus musculus multiple C2 domains, transmembrane 2 (Mctp2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mctp2 (244049)
Length:
4448
CDS:
86..1486

Additional Resources:

NCBI RefSeq record:
XM_011250864.1
NBCI Gene record:
Mctp2 (244049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414065 TTCATCCCTCTACGGTATATC pLKO_005 1286 CDS 100% 13.200 18.480 N Mctp2 n/a
2 TRCN0000028228 CCTCATATATAATCCGGTCAA pLKO.1 724 CDS 100% 4.050 5.670 N Mctp2 n/a
3 TRCN0000028257 CCTTATTCCATCGACAATAAT pLKO.1 1352 CDS 100% 1.500 1.200 N Mctp2 n/a
4 TRCN0000028277 CCAGTGAAAGACAGCAGATTT pLKO.1 306 CDS 100% 13.200 9.240 N Mctp2 n/a
5 TRCN0000412248 GAGACTGTGGGAGCTTCATAT pLKO_005 1714 3UTR 100% 13.200 9.240 N Mctp2 n/a
6 TRCN0000425947 TTCAATACCTTCGACAGATTT pLKO_005 1832 3UTR 100% 13.200 9.240 N Mctp2 n/a
7 TRCN0000425176 GACTTCAGACACATACCATTT pLKO_005 474 CDS 100% 10.800 7.560 N Mctp2 n/a
8 TRCN0000028250 GCCTGTTTGATTCTGGCCATA pLKO.1 1247 CDS 100% 4.050 2.835 N Mctp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.