Transcript: Mouse XM_011251006.2

PREDICTED: Mus musculus teneurin transmembrane protein 1 (Tenm1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tenm1 (23963)
Length:
13778
CDS:
984..9179

Additional Resources:

NCBI RefSeq record:
XM_011251006.2
NBCI Gene record:
Tenm1 (23963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011251006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112277 CGGTATAGTTATGATCTGAAT pLKO.1 7512 CDS 100% 4.950 6.930 N Tenm1 n/a
2 TRCN0000112278 GCACCTACATACCATGAACTT pLKO.1 5657 CDS 100% 4.950 3.960 N Tenm1 n/a
3 TRCN0000112279 CCTGACTTTGAGGTCATCATT pLKO.1 8052 CDS 100% 5.625 3.938 N Tenm1 n/a
4 TRCN0000112276 GCCTTGTTACTAGCCTATGTA pLKO.1 1974 CDS 100% 5.625 3.938 N Tenm1 n/a
5 TRCN0000005274 CGGCGTTACATCTTTGAGTAT pLKO.1 6696 CDS 100% 4.950 3.465 N TENM1 n/a
6 TRCN0000112275 GCGCAGAGATTACATCTCTTT pLKO.1 7864 CDS 100% 0.495 0.347 N Tenm1 n/a
7 TRCN0000432255 TAGGAGTAGATGCCAATATAA pLKO_005 7420 CDS 100% 15.000 10.500 N TENM1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 495 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011251006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.