Transcript: Human XM_011509092.2

PREDICTED: Homo sapiens lysine demethylase 5B (KDM5B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM5B (10765)
Length:
6375
CDS:
583..4743

Additional Resources:

NCBI RefSeq record:
XM_011509092.2
NBCI Gene record:
KDM5B (10765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329951 AGCCTGTAAACGGTGCTATTT pLKO_005 4844 3UTR 100% 13.200 18.480 N KDM5B n/a
2 TRCN0000014759 GCTCCCTTACTTTAGATGATA pLKO.1 2900 CDS 100% 5.625 7.875 N KDM5B n/a
3 TRCN0000014762 CGAGATGGAATTAACAGTCTT pLKO.1 4306 CDS 100% 4.950 6.930 N KDM5B n/a
4 TRCN0000358505 CACATATTACTGCTGATATAT pLKO_005 1526 CDS 100% 15.000 10.500 N KDM5B n/a
5 TRCN0000353576 GGACAACAGAACCTCATATTT pLKO_005 4065 CDS 100% 15.000 10.500 N KDM5B n/a
6 TRCN0000329952 ATCGCTTGCTTCATCGATATT pLKO_005 1961 CDS 100% 13.200 9.240 N KDM5B n/a
7 TRCN0000014760 CCTCTCCAAGATGTGGATATA pLKO.1 3616 CDS 100% 13.200 9.240 N KDM5B n/a
8 TRCN0000358504 GTGCCTGTTTACCGAACTAAT pLKO_005 1804 CDS 100% 13.200 9.240 N KDM5B n/a
9 TRCN0000329953 TGAGCGGTGGGAACGAGTTAA pLKO_005 4371 CDS 100% 13.200 9.240 N KDM5B n/a
10 TRCN0000014761 CCTGAGGAAGAGGAGTATCTT pLKO.1 1453 CDS 100% 5.625 3.938 N KDM5B n/a
11 TRCN0000113490 CGGTGCTATTTCTATTCCTTA pLKO.1 4854 3UTR 100% 4.950 3.465 N Kdm5b n/a
12 TRCN0000014758 CCCACCAATTTGGAAGGCATT pLKO.1 5012 3UTR 100% 4.050 2.835 N KDM5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.