Transcript: Human XM_011509140.3

PREDICTED: Homo sapiens niban apoptosis regulator 1 (NIBAN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NIBAN1 (116496)
Length:
7203
CDS:
295..3258

Additional Resources:

NCBI RefSeq record:
XM_011509140.3
NBCI Gene record:
NIBAN1 (116496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140244 GAGATCAAGGTAGCCCGTATT pLKO.1 3115 CDS 100% 10.800 15.120 N NIBAN1 n/a
2 TRCN0000145185 GCCTTGCATTACACATAGTAA pLKO.1 6699 3UTR 100% 5.625 7.875 N NIBAN1 n/a
3 TRCN0000143659 CCCAAGTATTACATCGTGGTT pLKO.1 4619 3UTR 100% 2.640 3.696 N NIBAN1 n/a
4 TRCN0000143030 CGTTCTGACATGGATCAGATT pLKO.1 1399 CDS 100% 0.495 0.693 N NIBAN1 n/a
5 TRCN0000121793 CCAATATGATTCACGTTGAAA pLKO.1 2066 CDS 100% 5.625 4.500 N NIBAN1 n/a
6 TRCN0000143323 GAAGGTTAAACTCCGAGTCTT pLKO.1 1893 CDS 100% 4.950 3.960 N NIBAN1 n/a
7 TRCN0000122258 CCCGTCAATTAAACAAACATT pLKO.1 4054 3UTR 100% 5.625 3.938 N NIBAN1 n/a
8 TRCN0000143791 GCTTCAGAAATACGAGCAGTT pLKO.1 2028 CDS 100% 4.050 2.835 N NIBAN1 n/a
9 TRCN0000140457 GCTGTCACACAAAGATGACGT pLKO.1 3183 CDS 100% 2.640 1.848 N NIBAN1 n/a
10 TRCN0000142997 CAGATGACATTTGAAGCCCAA pLKO.1 1084 CDS 100% 2.160 1.512 N NIBAN1 n/a
11 TRCN0000139587 CGTCCCAAGTAGCTGGAATTA pLKO.1 4781 3UTR 100% 13.200 7.920 N NIBAN1 n/a
12 TRCN0000139055 CCCTGGTTCAGCATCAAGTTT pLKO.1 1313 CDS 100% 5.625 3.375 N NIBAN1 n/a
13 TRCN0000122151 GCATCAAGTTTCAGAAGGATT pLKO.1 1323 CDS 100% 4.950 2.970 N NIBAN1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4919 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4919 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.