Transcript: Human XM_011509447.2

PREDICTED: Homo sapiens feline leukemia virus subgroup C cellular receptor 1 (FLVCR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLVCR1 (28982)
Length:
1404
CDS:
175..1272

Additional Resources:

NCBI RefSeq record:
XM_011509447.2
NBCI Gene record:
FLVCR1 (28982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059602 CGCGAAAGGATACCTCCCGTT pLKO.1 228 CDS 100% 0.720 1.008 N FLVCR1 n/a
2 TRCN0000425099 ACAAATCTCCTGGCTTGTAAT pLKO_005 973 CDS 100% 13.200 9.240 N FLVCR1 n/a
3 TRCN0000059598 CCCTGAAGAGTACTCCTATAA pLKO.1 1361 3UTR 100% 13.200 9.240 N FLVCR1 n/a
4 TRCN0000059599 CCAGTACAGCATCATTAGCAA pLKO.1 552 CDS 100% 3.000 2.100 N FLVCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.