Transcript: Human XM_011509603.2

PREDICTED: Homo sapiens phosducin (PDC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDC (5132)
Length:
2246
CDS:
1093..1833

Additional Resources:

NCBI RefSeq record:
XM_011509603.2
NBCI Gene record:
PDC (5132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064097 CAGGACCCAAAGGAGTAATAA pLKO.1 1151 CDS 100% 15.000 21.000 N PDC n/a
2 TRCN0000432011 CCTACACTGCTCATCTATAAA pLKO_005 1651 CDS 100% 15.000 21.000 N PDC n/a
3 TRCN0000064094 GATGGTATTAAGGGTTGTGAT pLKO.1 1519 CDS 100% 4.950 3.960 N PDC n/a
4 TRCN0000064095 GCCTAGATATGGGTTTGTGTA pLKO.1 1416 CDS 100% 4.950 3.960 N PDC n/a
5 TRCN0000434907 ATGTTTATCCTTTAGGTATTG pLKO_005 1856 3UTR 100% 10.800 7.560 N PDC n/a
6 TRCN0000034465 CCCAAAGGAGTAATAAATGAT pLKO.1 1156 CDS 100% 5.625 3.938 N Pdc n/a
7 TRCN0000064093 CCACCTAGCAAGAAGGAGATT pLKO.1 1219 CDS 100% 4.950 3.465 N PDC n/a
8 TRCN0000064096 GCTGAACAGTTTGCTGAAGAA pLKO.1 1705 CDS 100% 4.950 2.970 N PDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.