Transcript: Human XM_011509811.2

PREDICTED: Homo sapiens zinc finger protein 687 (ZNF687), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF687 (57592)
Length:
4381
CDS:
149..3685

Additional Resources:

NCBI RefSeq record:
XM_011509811.2
NBCI Gene record:
ZNF687 (57592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420462 GTGCGGATCAAGACCATTAAA pLKO_005 1136 CDS 100% 15.000 21.000 N ZNF687 n/a
2 TRCN0000005690 CGTCATGCAGTGCTCACATTT pLKO.1 1918 CDS 100% 13.200 10.560 N ZNF687 n/a
3 TRCN0000005687 GAAGAGCATTTGAGGATTATT pLKO.1 3818 3UTR 100% 15.000 10.500 N ZNF687 n/a
4 TRCN0000432056 TCTGAGCCCAACACTAATTAA pLKO_005 3909 3UTR 100% 15.000 10.500 N ZNF687 n/a
5 TRCN0000420430 CAACTTCCTGCAAGCCAATTT pLKO_005 2368 CDS 100% 13.200 9.240 N ZNF687 n/a
6 TRCN0000431803 GTTCCCTGAGCGTGATGAATA pLKO_005 2884 CDS 100% 13.200 9.240 N ZNF687 n/a
7 TRCN0000415944 AGAACCTGCTCCCTGCCTATA pLKO_005 1671 CDS 100% 10.800 7.560 N ZNF687 n/a
8 TRCN0000422358 CATCACCTCCTCTGCCATTAC pLKO_005 2065 CDS 100% 10.800 7.560 N ZNF687 n/a
9 TRCN0000424162 GTGATGGTGCAACCTTCAAAG pLKO_005 1559 CDS 100% 10.800 7.560 N ZNF687 n/a
10 TRCN0000005688 CCCTAAGATGATTGCTAAGAA pLKO.1 1447 CDS 100% 5.625 3.938 N ZNF687 n/a
11 TRCN0000005689 GCCTTTGACATCCCTGACATT pLKO.1 191 CDS 100% 4.950 3.465 N ZNF687 n/a
12 TRCN0000005691 CGACACAGTCTTCACTCACAA pLKO.1 2467 CDS 100% 4.950 2.970 N ZNF687 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.