Transcript: Human XM_011510573.3

PREDICTED: Homo sapiens collagen type V alpha 2 chain (COL5A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL5A2 (1290)
Length:
6044
CDS:
196..4557

Additional Resources:

NCBI RefSeq record:
XM_011510573.3
NBCI Gene record:
COL5A2 (1290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430369 AGAGGGTCTCAGTTCGCTTAT pLKO_005 4159 CDS 100% 10.800 8.640 N COL5A2 n/a
2 TRCN0000083979 GCGTTGAAATTGGGCCAGTTT pLKO.1 4526 CDS 100% 4.950 3.960 N COL5A2 n/a
3 TRCN0000431325 CAGTTGGTCCTTCAGGTAAAG pLKO_005 3596 CDS 100% 10.800 7.560 N COL5A2 n/a
4 TRCN0000083982 CCATCCAGTGTACCACGTAAA pLKO.1 4078 CDS 100% 10.800 7.560 N COL5A2 n/a
5 TRCN0000422597 GGGAGTCAAGTAGGACTAATG pLKO_005 670 CDS 100% 10.800 7.560 N COL5A2 n/a
6 TRCN0000083978 CCAATGACAATGACCACCTTT pLKO.1 4800 3UTR 100% 4.950 3.465 N COL5A2 n/a
7 TRCN0000090829 CCAGGATTAGTGCCTGTTGTA pLKO.1 409 CDS 100% 4.950 3.465 N Col5a2 n/a
8 TRCN0000083981 CCTGGTCCAAATGGTGAACAA pLKO.1 3526 CDS 100% 4.950 3.465 N COL5A2 n/a
9 TRCN0000083980 CCAGGCTCCATAGGAATCAAA pLKO.1 1861 CDS 100% 5.625 3.938 N COL5A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510573.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.