Transcript: Human XM_011511062.1

PREDICTED: Homo sapiens aldehyde oxidase 1 (AOX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AOX1 (316)
Length:
4310
CDS:
158..4210

Additional Resources:

NCBI RefSeq record:
XM_011511062.1
NBCI Gene record:
AOX1 (316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434678 ATGCGCTAGCGATAGTCAATT pLKO_005 1464 CDS 100% 13.200 18.480 N AOX1 n/a
2 TRCN0000046046 CCAGTTCACTATCCTAGCCTT pLKO.1 1772 CDS 100% 2.640 3.696 N AOX1 n/a
3 TRCN0000427149 GAGCCGCTGATACTAACAATT pLKO_005 2258 CDS 100% 13.200 10.560 N AOX1 n/a
4 TRCN0000046043 GCCAGATTGAAGGTGCATTTA pLKO.1 3762 CDS 100% 13.200 9.240 N AOX1 n/a
5 TRCN0000046047 CCTGAGAAGGTGCGAATCATA pLKO.1 2996 CDS 100% 5.625 3.938 N AOX1 n/a
6 TRCN0000046045 CCGTGAATTAAGAATGCCAAT pLKO.1 3337 CDS 100% 4.050 2.835 N AOX1 n/a
7 TRCN0000046044 CCACAGTAGAAGGCATAGGAA pLKO.1 417 CDS 100% 3.000 2.100 N AOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.