Transcript: Human XM_011511068.2

PREDICTED: Homo sapiens homeobox D13 (HOXD13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HOXD13 (3239)
Length:
2638
CDS:
456..1430

Additional Resources:

NCBI RefSeq record:
XM_011511068.2
NBCI Gene record:
HOXD13 (3239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274030 GAGTATGCCATTAACAAATTC pLKO_005 1278 CDS 100% 13.200 10.560 N HOXD13 n/a
2 TRCN0000019835 CGAAGAGTGAAGGACAAGAAA pLKO.1 1377 CDS 100% 5.625 3.938 N HOXD13 n/a
3 TRCN0000274032 CGAAGAGTGAAGGACAAGAAA pLKO_005 1377 CDS 100% 5.625 3.938 N HOXD13 n/a
4 TRCN0000019834 CCTGACTTTGTAGTTCTGATT pLKO.1 1604 3UTR 100% 4.950 3.465 N HOXD13 n/a
5 TRCN0000274029 CCTGACTTTGTAGTTCTGATT pLKO_005 1604 3UTR 100% 4.950 3.465 N HOXD13 n/a
6 TRCN0000019836 GCAGCTTAAAGAACTGGAGAA pLKO.1 1256 CDS 100% 4.050 2.835 N HOXD13 n/a
7 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 24 5UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.