Transcript: Human XM_011511105.2

PREDICTED: Homo sapiens NCK associated protein 5 (NCKAP5), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCKAP5 (344148)
Length:
7815
CDS:
922..6579

Additional Resources:

NCBI RefSeq record:
XM_011511105.2
NBCI Gene record:
NCKAP5 (344148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122808 GAGAGACACTTACGTCTTCAA pLKO.1 955 CDS 100% 4.950 6.930 N NCKAP5 n/a
2 TRCN0000143397 GATCTTCACATGGTGGTTGAT pLKO.1 1192 CDS 100% 4.950 6.930 N NCKAP5 n/a
3 TRCN0000121535 CGAAATCTATTGCAGAGTCAA pLKO.1 1075 CDS 100% 4.950 3.960 N NCKAP5 n/a
4 TRCN0000141763 GATGAGGATTCGAGGAGTGAA pLKO.1 1210 CDS 100% 4.950 3.465 N NCKAP5 n/a
5 TRCN0000144698 GATGGAAGAAACAGTACGAAA pLKO.1 1059 CDS 100% 4.950 3.465 N NCKAP5 n/a
6 TRCN0000141297 CAGCAGTACAGATGAGGGAAA pLKO.1 1233 CDS 100% 4.050 2.835 N NCKAP5 n/a
7 TRCN0000142493 GAGGAGAGACACTTACGTCTT pLKO.1 952 CDS 100% 4.050 2.835 N NCKAP5 n/a
8 TRCN0000143595 GAAGATCTTCACATGGTGGTT pLKO.1 1189 CDS 100% 2.640 1.848 N NCKAP5 n/a
9 TRCN0000141554 CGAGAAGTTGCCCAAAGAACA pLKO.1 889 5UTR 100% 4.950 2.970 N NCKAP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.