Transcript: Human XM_011511362.1

PREDICTED: Homo sapiens coiled-coil domain containing 93 (CCDC93), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC93 (54520)
Length:
6794
CDS:
436..1932

Additional Resources:

NCBI RefSeq record:
XM_011511362.1
NBCI Gene record:
CCDC93 (54520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262459 GACCTAGACAGACGGTATAAT pLKO_005 1390 CDS 100% 15.000 21.000 N CCDC93 n/a
2 TRCN0000262461 TTACTACAGGCTCGAAGAAAT pLKO_005 1441 CDS 100% 13.200 10.560 N CCDC93 n/a
3 TRCN0000062519 CGAGCTAATACAGTATCAGAA pLKO.1 1512 CDS 100% 4.950 3.960 N CCDC93 n/a
4 TRCN0000262460 CTAACCTGTGCCCTCATATTT pLKO_005 5068 3UTR 100% 15.000 10.500 N CCDC93 n/a
5 TRCN0000062518 CCAGCCTACAAGCCAGATATA pLKO.1 1058 CDS 100% 13.200 9.240 N CCDC93 n/a
6 TRCN0000262463 TTGGTTGCAGCTGGGTATTTC pLKO_005 248 5UTR 100% 13.200 9.240 N CCDC93 n/a
7 TRCN0000262462 GTATCACCACTTGCAACTTTG pLKO_005 327 5UTR 100% 10.800 7.560 N CCDC93 n/a
8 TRCN0000062521 GCAGAGGAGCTACTTGATGAA pLKO.1 598 CDS 100% 4.950 3.465 N CCDC93 n/a
9 TRCN0000062520 GCTATACTTTAAGACTGTGAA pLKO.1 1845 CDS 100% 4.950 3.465 N CCDC93 n/a
10 TRCN0000062522 GCTGAACTCAATTCATGAGAA pLKO.1 1650 CDS 100% 4.950 3.465 N CCDC93 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.