Transcript: Human XM_011511373.3

PREDICTED: Homo sapiens INO80 complex subunit D (INO80D), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INO80D (54891)
Length:
5141
CDS:
1818..4901

Additional Resources:

NCBI RefSeq record:
XM_011511373.3
NBCI Gene record:
INO80D (54891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426225 CACTACCTGGAAACCGAATTG pLKO_005 2238 CDS 100% 10.800 15.120 N INO80D n/a
2 TRCN0000427054 GAAATGCCGGCATACGTTTAG pLKO_005 3005 CDS 100% 10.800 15.120 N INO80D n/a
3 TRCN0000146763 CTATTGAATGGGCGTATAGTA pLKO.1 3963 CDS 100% 5.625 7.875 N INO80D n/a
4 TRCN0000127600 CAACATCGTACTCTGGTGATA pLKO.1 4360 CDS 100% 4.950 6.930 N INO80D n/a
5 TRCN0000422555 GTGAACAGTGCGCTAACAAAG pLKO_005 3175 CDS 100% 10.800 8.640 N INO80D n/a
6 TRCN0000419609 ATAAGCCCTTGTGCTCATATA pLKO_005 1858 CDS 100% 13.200 9.240 N INO80D n/a
7 TRCN0000147250 GCACTTACTTTCAGCAGAAAT pLKO.1 2941 CDS 100% 13.200 9.240 N INO80D n/a
8 TRCN0000426618 TGAATATGTGGCCAAGTATAA pLKO_005 1970 CDS 100% 13.200 9.240 N INO80D n/a
9 TRCN0000436066 AGAGGAGATAACTCCCGTAAA pLKO_005 3372 CDS 100% 10.800 7.560 N INO80D n/a
10 TRCN0000251234 ATGAGTTGCCGGATGACATTG pLKO_005 3607 CDS 100% 10.800 7.560 N Ino80d n/a
11 TRCN0000424506 GAGCAAGGCAGATGACCTAAT pLKO_005 4226 CDS 100% 10.800 7.560 N INO80D n/a
12 TRCN0000149662 GAGCTATTGAATGGGCGTATA pLKO.1 3960 CDS 100% 10.800 7.560 N INO80D n/a
13 TRCN0000129770 CCATTTGCTTTCAATGAGGAA pLKO.1 2265 CDS 100% 2.640 1.848 N INO80D n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 32 5UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 32 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.