Transcript: Human XM_011511505.3

PREDICTED: Homo sapiens solute carrier family 39 member 10 (SLC39A10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC39A10 (57181)
Length:
5403
CDS:
249..2744

Additional Resources:

NCBI RefSeq record:
XM_011511505.3
NBCI Gene record:
SLC39A10 (57181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511505.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072832 CACGATCATGTTTCTCATTTA pLKO.1 564 CDS 100% 13.200 9.240 N SLC39A10 n/a
2 TRCN0000072831 GCCACATGAATTAGGAGATTT pLKO.1 2381 CDS 100% 13.200 9.240 N SLC39A10 n/a
3 TRCN0000072830 CCCAGGAACAATCTGATGTTA pLKO.1 907 CDS 100% 5.625 3.938 N SLC39A10 n/a
4 TRCN0000072828 GCTCTTTAATTCAGCTACATA pLKO.1 3170 3UTR 100% 5.625 3.938 N SLC39A10 n/a
5 TRCN0000072829 CTGAGGTTATTACACCAGGTT pLKO.1 979 CDS 100% 2.640 1.848 N SLC39A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511505.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.