Transcript: Human XM_011511698.2

PREDICTED: Homo sapiens secreted phosphoprotein 2 (SPP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPP2 (6694)
Length:
1332
CDS:
117..752

Additional Resources:

NCBI RefSeq record:
XM_011511698.2
NBCI Gene record:
SPP2 (6694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162996 GATCCATCCTCCTTAAGGGAT pLKO.1 222 CDS 100% 2.640 3.696 N SPP2 n/a
2 TRCN0000159030 GACATGTTGGGATCTCATAAA pLKO.1 573 CDS 100% 13.200 9.240 N SPP2 n/a
3 TRCN0000158498 CAACTTGGTCATGAATTTAGA pLKO.1 347 CDS 100% 5.625 3.938 N SPP2 n/a
4 TRCN0000164645 GACTACGATCCATCCTCCTTA pLKO.1 216 CDS 100% 4.950 3.465 N SPP2 n/a
5 TRCN0000158989 GATCTCATAAATGGAGAAACA pLKO.1 583 CDS 100% 4.950 3.465 N SPP2 n/a
6 TRCN0000159779 GATTATGTTTGCTCTTGGAAT pLKO.1 161 CDS 100% 4.950 3.465 N SPP2 n/a
7 TRCN0000163229 GTCACTGAGTCCGTATCTGTT pLKO.1 278 CDS 100% 4.950 3.465 N SPP2 n/a
8 TRCN0000162997 GTCTTACAGCAGCGAAGAGAT pLKO.1 542 CDS 100% 4.950 3.465 N SPP2 n/a
9 TRCN0000162641 CTCTTGGAATGAACTACTGGT pLKO.1 172 CDS 100% 2.640 1.848 N SPP2 n/a
10 TRCN0000161388 GAATGAACTACTGGTCTTGCT pLKO.1 178 CDS 100% 2.640 1.848 N SPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.