Transcript: Human XM_011511701.3

PREDICTED: Homo sapiens ITPR interacting domain containing 2 (ITPRID2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPRID2 (6744)
Length:
4289
CDS:
320..3193

Additional Resources:

NCBI RefSeq record:
XM_011511701.3
NBCI Gene record:
ITPRID2 (6744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140203 GCATTCCGATAGCAGTGGTTT pLKO.1 1831 CDS 100% 4.950 6.930 N ITPRID2 n/a
2 TRCN0000140159 GCTAGGTCTTACGAAGTCGAA pLKO.1 1780 CDS 100% 2.640 3.696 N ITPRID2 n/a
3 TRCN0000145533 CCATCATCTGTGAAGAAAGAA pLKO.1 2729 CDS 100% 5.625 3.938 N ITPRID2 n/a
4 TRCN0000122570 CCACTGACAATACCATCCATA pLKO.1 1667 CDS 100% 4.950 3.465 N ITPRID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.