Transcript: Human XM_011512080.2

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 11 (ABCB11), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB11 (8647)
Length:
3125
CDS:
200..3010

Additional Resources:

NCBI RefSeq record:
XM_011512080.2
NBCI Gene record:
ABCB11 (8647)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413748 ATTAGCTGTTGTAGATCATAA pLKO_005 2434 CDS 100% 13.200 10.560 N ABCB11 n/a
2 TRCN0000425396 GGGAGCTACCAGGATAGTTTA pLKO_005 2354 CDS 100% 13.200 10.560 N ABCB11 n/a
3 TRCN0000419038 AGCATGGGCACACAATCATTT pLKO_005 2115 CDS 100% 13.200 9.240 N ABCB11 n/a
4 TRCN0000059360 CCCATGAAGAATTACTGGAAA pLKO.1 2217 CDS 100% 4.950 3.465 N ABCB11 n/a
5 TRCN0000059358 GCCATGACATTCGCTCTCTTA pLKO.1 1749 CDS 100% 4.950 3.465 N ABCB11 n/a
6 TRCN0000059359 GCCAGTTACTATGCTGGAATT pLKO.1 725 CDS 100% 0.000 0.000 N ABCB11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.