Transcript: Human XM_011512221.1

PREDICTED: Homo sapiens histone deacetylase 4 (HDAC4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC4 (9759)
Length:
8664
CDS:
466..3735

Additional Resources:

NCBI RefSeq record:
XM_011512221.1
NBCI Gene record:
HDAC4 (9759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004829 CGACTCATCTTGTAGCTTATT pLKO.1 4196 3UTR 100% 13.200 18.480 N HDAC4 n/a
2 TRCN0000314666 CGACTCATCTTGTAGCTTATT pLKO_005 4196 3UTR 100% 13.200 18.480 N HDAC4 n/a
3 TRCN0000199110 CCAATGCAAACGCTGTCCGTT pLKO.1 3506 CDS 100% 2.640 3.696 N HDAC4 n/a
4 TRCN0000314737 CGGAGTGTCGACCTCCTATAA pLKO_005 1122 CDS 100% 13.200 10.560 N HDAC4 n/a
5 TRCN0000314735 CAAGAATTTGTCCTCAATAAA pLKO_005 991 CDS 100% 15.000 10.500 N HDAC4 n/a
6 TRCN0000380246 AGAAACTGGACAGTAAGAAAC pLKO_005 2672 CDS 100% 10.800 7.560 N HDAC4 n/a
7 TRCN0000314667 GAATCTGAACCACTGCATTTC pLKO_005 1032 CDS 100% 10.800 7.560 N HDAC4 n/a
8 TRCN0000379720 TTCTGCAGCACATGGTCTTAC pLKO_005 1703 CDS 100% 10.800 7.560 N HDAC4 n/a
9 TRCN0000004830 CGTGGGTTTCAACGTCAACAT pLKO.1 3135 CDS 100% 4.950 3.465 N HDAC4 n/a
10 TRCN0000004831 GCAGCTCAAGAACAAGGAGAA pLKO.1 924 CDS 100% 4.050 2.835 N HDAC4 n/a
11 TRCN0000004832 GCCAAAGATGACTTCCCTCTT pLKO.1 1168 CDS 100% 4.050 2.835 N HDAC4 n/a
12 TRCN0000314665 GCCAAAGATGACTTCCCTCTT pLKO_005 1168 CDS 100% 4.050 2.835 N HDAC4 n/a
13 TRCN0000004833 GTTACAAGAATTTGTCCTCAA pLKO.1 987 CDS 100% 4.050 2.430 N HDAC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.