Transcript: Human XM_011512230.1

PREDICTED: Homo sapiens histone deacetylase 4 (HDAC4), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC4 (9759)
Length:
7862
CDS:
912..2933

Additional Resources:

NCBI RefSeq record:
XM_011512230.1
NBCI Gene record:
HDAC4 (9759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004829 CGACTCATCTTGTAGCTTATT pLKO.1 3394 3UTR 100% 13.200 18.480 N HDAC4 n/a
2 TRCN0000314666 CGACTCATCTTGTAGCTTATT pLKO_005 3394 3UTR 100% 13.200 18.480 N HDAC4 n/a
3 TRCN0000199110 CCAATGCAAACGCTGTCCGTT pLKO.1 2704 CDS 100% 2.640 3.696 N HDAC4 n/a
4 TRCN0000380246 AGAAACTGGACAGTAAGAAAC pLKO_005 1870 CDS 100% 10.800 7.560 N HDAC4 n/a
5 TRCN0000379720 TTCTGCAGCACATGGTCTTAC pLKO_005 901 5UTR 100% 10.800 7.560 N HDAC4 n/a
6 TRCN0000004830 CGTGGGTTTCAACGTCAACAT pLKO.1 2333 CDS 100% 4.950 3.465 N HDAC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.