Transcript: Human XM_011512367.3

PREDICTED: Homo sapiens HERV-H LTR-associating 2 (HHLA2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHLA2 (11148)
Length:
2101
CDS:
285..1424

Additional Resources:

NCBI RefSeq record:
XM_011512367.3
NBCI Gene record:
HHLA2 (11148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137614 CGGTTGTATCAGGGTAACCAA pLKO.1 1913 3UTR 100% 3.000 4.200 N HHLA2 n/a
2 TRCN0000136483 CCAACTCGATTTGGGATGAAT pLKO.1 1930 3UTR 100% 5.625 3.938 N HHLA2 n/a
3 TRCN0000135009 CCACTAAGAATCTGGAAGAAA pLKO.1 1738 3UTR 100% 5.625 3.938 N HHLA2 n/a
4 TRCN0000136482 CCTGGATGTTAAGGATTCCAA pLKO.1 1643 3UTR 100% 3.000 2.100 N HHLA2 n/a
5 TRCN0000134144 CATATTCCCTTTGGCTTTCTT pLKO.1 350 CDS 100% 5.625 3.375 N HHLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.