Transcript: Human XM_011512681.2

PREDICTED: Homo sapiens fetuin B (FETUB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FETUB (26998)
Length:
1928
CDS:
403..1551

Additional Resources:

NCBI RefSeq record:
XM_011512681.2
NBCI Gene record:
FETUB (26998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372241 CTTTGCCCTGCGGGATATTAA pLKO_005 540 CDS 100% 15.000 21.000 N FETUB n/a
2 TRCN0000073615 GCAAAGGTTCTCTGACTCGAA pLKO.1 1112 CDS 100% 2.640 3.696 N FETUB n/a
3 TRCN0000073614 CCAAGTAGAGTTCTCTATTTA pLKO.1 778 CDS 100% 15.000 10.500 N FETUB n/a
4 TRCN0000372187 CACCGAGTCTCTTGCGAAATA pLKO_005 915 CDS 100% 13.200 9.240 N FETUB n/a
5 TRCN0000073616 GCCAAGAGGATCTGTCCAATA pLKO.1 1299 CDS 100% 10.800 7.560 N FETUB n/a
6 TRCN0000372242 TGAATCAGTTTATGGTCAATG pLKO_005 732 CDS 100% 10.800 7.560 N FETUB n/a
7 TRCN0000073617 CCAGGGAGAAACCCTGGATAT pLKO.1 1404 CDS 100% 1.080 0.648 N FETUB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.