Transcript: Human XM_011513078.2

PREDICTED: Homo sapiens sucrase-isomaltase (SI), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SI (6476)
Length:
6015
CDS:
167..5551

Additional Resources:

NCBI RefSeq record:
XM_011513078.2
NBCI Gene record:
SI (6476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415022 ACTATTCGCTACACCTTATTA pLKO_005 2135 CDS 100% 15.000 21.000 N SI n/a
2 TRCN0000049567 CCCTCAATTTGTGCAAGATTT pLKO.1 1291 CDS 100% 13.200 18.480 N SI n/a
3 TRCN0000428087 ACATCTTAGAGGAGGTTATAT pLKO_005 2434 CDS 100% 15.000 10.500 N SI n/a
4 TRCN0000049565 CCAGACAAGATAACTCTTATT pLKO.1 2997 CDS 100% 13.200 9.240 N SI n/a
5 TRCN0000049563 CCGTGGAATGACTCTCTTATT pLKO.1 356 CDS 100% 13.200 9.240 N SI n/a
6 TRCN0000049564 GCCCAACATAACAATAGATAA pLKO.1 4081 CDS 100% 13.200 9.240 N SI n/a
7 TRCN0000414388 TATGATCAAGTTGCGTTTAAC pLKO_005 1265 CDS 100% 13.200 9.240 N SI n/a
8 TRCN0000049566 GCCAGAGAAATTGTGGACTTT pLKO.1 4190 CDS 100% 4.950 3.465 N SI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.