Transcript: Human XM_011513269.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 13 (USP13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP13 (8975)
Length:
7853
CDS:
29..2593

Additional Resources:

NCBI RefSeq record:
XM_011513269.1
NBCI Gene record:
USP13 (8975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007251 CGATTTAAATAGCGACGATTA pLKO.1 400 CDS 100% 10.800 15.120 N USP13 n/a
2 TRCN0000279829 CGATTTAAATAGCGACGATTA pLKO_005 400 CDS 100% 10.800 15.120 N USP13 n/a
3 TRCN0000007249 GCCAGTATCTAAATATGCCAA pLKO.1 586 CDS 100% 2.640 2.112 N USP13 n/a
4 TRCN0000279837 GCCAGTATCTAAATATGCCAA pLKO_005 586 CDS 100% 2.640 2.112 N USP13 n/a
5 TRCN0000007252 CCGGTGAAATCTGAACTCATT pLKO.1 1235 CDS 100% 4.950 3.465 N USP13 n/a
6 TRCN0000297729 CCGGTGAAATCTGAACTCATT pLKO_005 1235 CDS 100% 4.950 3.465 N USP13 n/a
7 TRCN0000007248 GCAGATAAAGAAGTTCACTTT pLKO.1 1777 CDS 100% 4.950 2.970 N USP13 n/a
8 TRCN0000297325 GCAGATAAAGAAGTTCACTTT pLKO_005 1777 CDS 100% 4.950 2.970 N USP13 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6303 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6303 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.