Transcript: Human XM_011513557.2

PREDICTED: Homo sapiens nuclear receptor binding SET domain protein 2 (NSD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSD2 (7468)
Length:
7451
CDS:
56..4153

Additional Resources:

NCBI RefSeq record:
XM_011513557.2
NBCI Gene record:
NSD2 (7468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019815 GCACGCTACAACACCAAGTTT pLKO.1 1553 CDS 100% 5.625 7.875 N NSD2 n/a
2 TRCN0000274233 ATCTTACTTCCCGGGTGTTTA pLKO_005 297 CDS 100% 13.200 9.240 N NSD2 n/a
3 TRCN0000019818 CCCAGAAAGAGCTTGGATATT pLKO.1 865 CDS 100% 13.200 9.240 N NSD2 n/a
4 TRCN0000274183 CCCAGAAAGAGCTTGGATATT pLKO_005 865 CDS 100% 13.200 9.240 N NSD2 n/a
5 TRCN0000274232 GATGAAGCAGGCACCAGAAAT pLKO_005 115 CDS 100% 13.200 9.240 N NSD2 n/a
6 TRCN0000019816 CCTCTCTTTGAATCTTCCATT pLKO.1 464 CDS 100% 4.950 3.465 N NSD2 n/a
7 TRCN0000019817 CGGAAAGCCAAGTTCACCTTT pLKO.1 1073 CDS 100% 4.950 3.465 N NSD2 n/a
8 TRCN0000274182 CGGAAAGCCAAGTTCACCTTT pLKO_005 1073 CDS 100% 4.950 3.465 N NSD2 n/a
9 TRCN0000218710 CCAGAAAGAGCTTGGATATTT pLKO_005 866 CDS 100% 15.000 9.000 N Nsd2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000110441 CCCTTCGCAGTGTTTGTCTTA pLKO.1 6927 3UTR 100% 4.950 3.960 N Abo n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.